Unconventional codon reading by Mycoplasma mycoides tRNAs as revealed by partial sequence analysis.

نویسندگان

  • Y S Guindy
  • T Samuelsson
  • T I Johansen
چکیده

Continuing our investigation of the tRNA genes and gene products in Mycoplasma mycoides, we report the sequence of the gene for tRNALeu (CAA) as well as partial primary structures of the following tRNAs: Leu (CAA), Leu (UAG), Arg (UCU), Thr (AGU) and Ile (CAU). It is suggested that in M. mycoides, at least some of the family codon boxes are read by only one tRNA each, using an unconventional method which does not discriminate between the nucleotides in the third codon position. M. mycoides is the first free-living organism known to use an unconventional method of this kind.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Variability of a glucose phosphotransferase system permease in Mycoplasma mycoides subsp. mycoides Small Colony.

Intraclonal antigenic variation in pathogenic mycoplasma species is considered an important feature of host-pathogen interaction. Such intraclonal protein variation was observed for the interaction of Mycoplasma mycoides subsp. mycoides Small Colony, the agent of contagious bovine pleuropneumonia, with mAb 3F3. Colony immunostaining allows the definition of 3F3 ON- and 3F3 OFF-type variants, wh...

متن کامل

A Type III restriction–modification system in Mycoplasma mycoides subsp. capri

The sequenced genome of Mycoplasma mycoides subsp. capri revealed the presence of a Type III restriction-modification system (MmyCI). The methyltransferase (modification) subunit of MmyCI (M.MmyCI) was shown to recognize the sequence 5'-TGAG-3' and methylate the adenine. The coding region of the methyltransferase gene contains 12 consecutive AG dinucleotide repeats that result in a translationa...

متن کامل

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...

متن کامل

Genomic and antigenic differences between the European and African/Australian clusters of Mycoplasma mycoides subsp. mycoides SC.

Mycoplasma mycoides subsp. mycoides small-colony type (SC), the aetiological agent of contagious bovine pleuropneumonia (CBPP), can be grouped into two major, epidemiologically distinct, clusters. One cluster contains strains isolated from different European countries since 1980 and a second cluster contains African and Australian strains collected over the last 50 years. Genetic analysis of re...

متن کامل

Codon reading scheme in Mycoplasma pneumoniae revealed by the analysis of the complete set of tRNA genes.

The 33 genes encoding the complete set of tRNA species in Mycoplasma pneumoniae have been cloned and sequenced. They are organized into 5 clusters in addition to 9 single genes. No redundant gene was found, indicating that 33 tRNAs correspond to 32 different anticodons and decode all 62 codons used in this organism. There is only one single tRNA for each of the Ala, Leu, Pro, and Val family box...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • The Biochemical journal

دوره 258 3  شماره 

صفحات  -

تاریخ انتشار 1989